Hello Gloria, looking at your strand of RNA, I can see that you have 5 nucleobases in the strand, which is an improper string for either DNA and RNA. Going from DNA to RNA the nucleobases are converted as such: T -> A G -> C C -> G A -> U (DNA doesn't have uracil and RNA doesn't have thymine.) I would be happy to decode your message as soon as you correct your string.
You are correct in the errors you pointed out. There should be no uracils in the DNA molecule. Sometimes one or two are put in there mistakenly by students in the random bases at the beginning and end, but these are distributed throughout.
I tried assuming that the molecule was meant to be a DNA molecule and the U's were really meant to be T's. With that assumption, all U's and T's were transcribed into A's, but that didn't get very far. A start codon does appear but towards the end of the code.
Gloria, some feedback on what the sentence was supposed to say would be helpful and perhaps you can rethink the code to correct the errors. In the meantime, below is my attempt to decode what you have now.
DNA: TAUTGUGGGTCGGATAAAUCGCTAGTGUCCTACUTUAG RNA: AUAACACCCAGCCUAUUUAGCGAUCACAGGAUGAAAUC AUG AAA UC (start) Delirium UC
Hello Gloria, looking at your strand of RNA, I can see that you have 5 nucleobases in the strand, which is an improper string for either DNA and RNA. Going from DNA to RNA the nucleobases are converted as such:
ReplyDeleteT -> A
G -> C
C -> G
A -> U
(DNA doesn't have uracil and RNA doesn't have thymine.)
I would be happy to decode your message as soon as you correct your string.
Pedro, I will offer a response.
ReplyDeleteYou are correct in the errors you pointed out. There should be no uracils in the DNA molecule. Sometimes one or two are put in there mistakenly by students in the random bases at the beginning and end, but these are distributed throughout.
I tried assuming that the molecule was meant to be a DNA molecule and the U's were really meant to be T's. With that assumption, all U's and T's were transcribed into A's, but that didn't get very far. A start codon does appear but towards the end of the code.
Gloria, some feedback on what the sentence was supposed to say would be helpful and perhaps you can rethink the code to correct the errors. In the meantime, below is my attempt to decode what you have now.
DNA: TAUTGUGGGTCGGATAAAUCGCTAGTGUCCTACUTUAG
RNA: AUAACACCCAGCCUAUUUAGCGAUCACAGGAUGAAAUC
AUG AAA UC
(start) Delirium UC